View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2337_low_19 (Length: 248)

Name: NF2337_low_19
Description: NF2337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2337_low_19
NF2337_low_19
[»] chr1 (1 HSPs)
chr1 (1-244)||(3925649-3925892)


Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 3925649 - 3925892
Alignment:
1 atgactaaatattctaacacacctaggatagcgctgcatacatacaagcataaaacaaaattaaaaaagtgtcaatgattaacatgtattttcagtacgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
3925649 atgactaaatattctaacacacctaggatagcgctgcatacatacaagcatcaaacaaaattaaaaaagtgtcaatgattaacatgtattttcagtacgt 3925748  T
101 ttatagattaggatgtgtttagatgaatttttagaaaagcaaaaccgcgatgaatgttgataaacacaaataatatagagatgaatttggaaaacaaaca 200  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
3925749 tcatagattaggatgtgtttagatgaatttttagaaaagcaaaaccgcgatgaatgttgataaacacaaataatatagagatgaatttggaaaacataca 3925848  T
201 tacctcttgaagaaaaccaaaaatagagaggcttagaataattt 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
3925849 tacctcttgaagaaaaccaaaaatagagaggcttagaataattt 3925892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University