View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2338_low_3 (Length: 324)
Name: NF2338_low_3
Description: NF2338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2338_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 1383049 - 1382748
Alignment:
| Q |
1 |
ctgaattcagagcaacctcatattattgtaagtgttgttacaatcttgtaattttattatttcaatttaccactgcttctaannnnnnn-atttc----- |
94 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
1383049 |
ctgaattcagagcaacctcgtattattgtaagggttgttacaatcttgtaattttattatttcaatttatcactgcttctaattttttttatttcttacc |
1382950 |
T |
|
| Q |
95 |
----aaggttgggaggcctgacctaatcttatatcacctaaaacacacccaaggattttctcttgctcttgctagtttaaagtacctggtatgatttgat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1382949 |
cttcaaggttgggaggcctgacctaatcttatatcacctaaaacacacccaaggattttctcttgctcttgctagtttaaagtacctggtatgatttgat |
1382850 |
T |
|
| Q |
191 |
tgataccgtttttacattattacaaaatcaaatatttcatatatcttgtctttactttcactgctctgctcgcaggtcatagatgatgcacacctgctat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1382849 |
tgataccgtttttacattattacaaaatcaaatatttcatatatcttgtctttactttcactgctctgctcgcaggtcatagatgatgcacacctgctat |
1382750 |
T |
|
| Q |
291 |
ct |
292 |
Q |
| |
|
|| |
|
|
| T |
1382749 |
ct |
1382748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 11924708 - 11924740
Alignment:
| Q |
123 |
atcacctaaaacacacccaaggattttctcttg |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
11924708 |
atcacctaaaacacaccgaaggattttctcttg |
11924740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University