View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2338_low_4 (Length: 282)
Name: NF2338_low_4
Description: NF2338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2338_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 39982578 - 39982320
Alignment:
| Q |
19 |
tcagcagccccttttgccatgcacacacagtgccccatcactttatatgcagatcttctcctatattgcacaaatttaaaggcaaataggcctaacatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39982578 |
tcagcagccccttttgccatgcacacacagtgccccatcactttatatgcagatcttctcctatattgcacaaatttaaaggcaaataggcctaacatga |
39982479 |
T |
|
| Q |
119 |
cacaaatccacagagcaaatacccaggatcttcgccagttatcctggaagaagtacttggtatctctataccacctcttaataggatttccctcaaatgt |
218 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39982478 |
caccaatccacagagcaaatacccaggatcttcgccagttatcctggaagaagtacttggtatctctataccacctcttaataggatttccctcaaatgt |
39982379 |
T |
|
| Q |
219 |
aggcctaagcttttggcttagcatttggctcaggtacttactttctccccttgtagtct |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39982378 |
aggcctaagcttttggcttagcatttggctcaggtacttactttctccccttgtagtct |
39982320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 44885334 - 44885223
Alignment:
| Q |
19 |
tcagcagccccttttgccatgcacacacagtgccccatcactttatatgcagatcttctcctatattgcacaaatttaaaggcaaataggcctaacatga |
118 |
Q |
| |
|
||||| || ||||| |||||||| ||||| || |||||||| | ||| |||| | |||| | ||| ||||||||||| |||||||||| |||||||| | |
|
|
| T |
44885334 |
tcagctgcacctttagccatgcaaacacaatggcccatcacctcataagcagcttttcttcgatactgcacaaatttgtaggcaaatagacctaacataa |
44885235 |
T |
|
| Q |
119 |
cacaaatccaca |
130 |
Q |
| |
|
| | |||||||| |
|
|
| T |
44885234 |
ctccaatccaca |
44885223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 224 - 266
Target Start/End: Complemental strand, 44914371 - 44914329
Alignment:
| Q |
224 |
taagcttttggcttagcatttggctcaggtacttactttctcc |
266 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
44914371 |
taagctttatgcttagcatttggctcaggtacttactatctcc |
44914329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University