View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2339_high_14 (Length: 251)
Name: NF2339_high_14
Description: NF2339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2339_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 25 - 238
Target Start/End: Complemental strand, 42331950 - 42331737
Alignment:
| Q |
25 |
aaaataaatgaatcgaattacgcagcttaatttgttattgttacgaactgaatccatcactcagaaggtactatgaattcaaagcagtgtaggccatcca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331950 |
aaaataaatgaatcgaattacgcagcttaatttgttattgttacgaactgaatccatcactcagaaggtactatgaattcaaagcagtgtaggccatcca |
42331851 |
T |
|
| Q |
125 |
actccggtgcaaacctttgtcttgaaggggccgggatttgcttgtctccactgggtgttgatgtttttggatttttccctgtggttttggattcggtcgc |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331850 |
actccggtgcaaacctttgtctcgaaggggccgggatttgcttgtcttcactgggtgttgatgtttttggatttttccctgtggttttggattcggtcgc |
42331751 |
T |
|
| Q |
225 |
ttctttattagcct |
238 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42331750 |
ttctttattagcct |
42331737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University