View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2339_low_12 (Length: 369)
Name: NF2339_low_12
Description: NF2339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2339_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 49 - 340
Target Start/End: Complemental strand, 20713266 - 20712975
Alignment:
| Q |
49 |
cagagaatgggaggtagcgttccttcgttgttagctactgatgccgcgtcttgtgtttcggttgctgaaaggatgatcgcgcttggtactcaggctggga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713266 |
cagagaatgggaggtagcgttccttcgttgttagctactgatgccgcgtcttgtgtttcggttgctgaaaggatgatcgcgcttggtactcaggctggga |
20713167 |
T |
 |
| Q |
149 |
ctattcatattcttgattttctcgggaatcaggtttgttagcattgcattgattcgttgtttatcgtcgaaagttcaataattgtggtgaatttgtagta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20713166 |
ctattcatattcttgattttctcgggaatcaggtttgttagcattgcattgattcgttgtttatcgtcgaaagttcaataattgtggtgaatttatagta |
20713067 |
T |
 |
| Q |
249 |
ttttgattaaattggagttagttagatcaaatttgaagaagtaattgatcaaatcaaagtatgtttagattaagaaaaattattgtgttttt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20713066 |
ttttgattaaattggagttagttagatcaaatttgaagaagtaattgatcaaatcaaagtatgtttagattaagaaaaattattgtgttttt |
20712975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University