View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2339_low_21 (Length: 277)
Name: NF2339_low_21
Description: NF2339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2339_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 202
Target Start/End: Original strand, 50336965 - 50337111
Alignment:
| Q |
56 |
cgttacccaatcagaaatggatcctcaccgtcgaatttgcaacccgaaaccaccgcagagcttgatatgtttctggaacttcttcctttggagatgagga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336965 |
cgttacccaatcagaaatggatcctcaccgtcgaatttgcaacccgaaaccaccgcagagcttgatatgtttctggaacttcttcctttggagatgagga |
50337064 |
T |
|
| Q |
156 |
tggaattgtatcgtcaccaagagattggtggactcattgaagttgtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337065 |
tggaattgtatcgtcaccaagagattggtggactcattgaagttgtt |
50337111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 244
Target Start/End: Original strand, 19159266 - 19159316
Alignment:
| Q |
194 |
gaagttgttcttatcggaataatattgctgccaatctggacgtctgtggtg |
244 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
19159266 |
gaagttatccttatcggaataatactgctgccaatctggatgtttgtggtg |
19159316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University