View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2339_low_9 (Length: 403)
Name: NF2339_low_9
Description: NF2339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2339_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 27 - 134
Target Start/End: Original strand, 42332063 - 42332170
Alignment:
| Q |
27 |
ttgtcgtgaagctgtaaaagaagtctatggatcacaggattggtttctgaattgggactagttgatcgatccacaccatgcattcaatgtgacagtcaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42332063 |
ttgtcgtgaagctgtaaaagaagtctatggatcacaggattggtttctgaattgggactagttgatcgatccacaccatgcattcaatgtgacagtcaaa |
42332162 |
T |
|
| Q |
127 |
gtgttata |
134 |
Q |
| |
|
|||||||| |
|
|
| T |
42332163 |
gtgttata |
42332170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 272 - 371
Target Start/End: Original strand, 42332283 - 42332382
Alignment:
| Q |
272 |
atttatgtatgtgttttgattgctgcctattttttcataaccaatttgatgtgactatcacacgcatactataatagcatctccgaccaatgatatagct |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42332283 |
atttatgtatgtgttttgattgctgcctattttttcataaccaatttgatgtgactatcacactcatactataatagcatctccgaccaatgatatagct |
42332382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 42332200 - 42332263
Alignment:
| Q |
212 |
ttcaattcctcatccacagcgcgtaacatatgaagcatgtgctgaagtttcttttcagtcattt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42332200 |
ttcaattcctcatccacagcgcgtaacatatgaagcatctgctgaagtttcttttcagtcattt |
42332263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University