View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2341_low_3 (Length: 356)
Name: NF2341_low_3
Description: NF2341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2341_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 338
Target Start/End: Original strand, 7465435 - 7465765
Alignment:
| Q |
8 |
agaatatgggaatcaagggcggactcagccaaattatggcacgtgcatccannnnnnncagaggtgtttttcaaagtctgtcagttgctggataatggag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465435 |
agaatatgggaatcaagggcggactcaggcaaattatggcacgtgcatccatttttttcagaggtgtttttcaaagtctgtcagttgctggataatggag |
7465534 |
T |
|
| Q |
108 |
ttttggcctcattttgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaagattactctcaggcactggctat |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465535 |
ttttggcctcatttcgcatggttttatggagtctttggaatagaagaaatacaaaagtattggatggcttgcaaaaagattactctcaggcactggctat |
7465634 |
T |
|
| Q |
208 |
ggcatataaagtgatgcaatcttggtgtcatgctcggcctgctcataacagagacaacatgcgacagtaggtgcattaattgcaacattgacgctgctac |
307 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7465635 |
ggcatatcaagtgatgcaatcttggtgtcatgctcggcctgctcatagcagagacaacacgcgacagtaggtgcattaattgcaacattgacgctgctac |
7465734 |
T |
|
| Q |
308 |
tttcactgcatcaaactgttggtatgggtgc |
338 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
7465735 |
tttcactgcatcagactgttggtatgggtgc |
7465765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University