View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2342_high_11 (Length: 270)
Name: NF2342_high_11
Description: NF2342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2342_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 119 - 254
Target Start/End: Original strand, 40750803 - 40750938
Alignment:
| Q |
119 |
aagttataatttaataggtaatctattttttcaaaggatagaataaactatttattgctcctttttaaatnnnnnnnctctttattgttgaccatcggtg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40750803 |
aagttataatttaataggtaatctattttttcaaaggatagaataaactatttattgctccttttcaaataaaaaaactctttattgttgaccatcggtg |
40750902 |
T |
 |
| Q |
219 |
aaaatcccagtcatggtcaaaccttggtgttgatag |
254 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40750903 |
aaaatccgagtcatggtcaaaccttggtgttgatag |
40750938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 106
Target Start/End: Original strand, 40750617 - 40750716
Alignment:
| Q |
7 |
tgagatgaatactgaatttctcgagtcgtgcataatagttgttggttttgttgttctgtcttaacgttgttatcgtttttggcttctcttacttgaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40750617 |
tgagatgaatactgaatttctcgagtcgtgcataatagttgttggttttgttgttctgtcttaacgttgttatcgtttttggcttctcttacttgaaaca |
40750716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University