View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2342_high_15 (Length: 227)
Name: NF2342_high_15
Description: NF2342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2342_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 30671072 - 30670851
Alignment:
| Q |
7 |
tgttgatcctaacctgaattaaaggtt-agtggtgtcaaactcactactttgatctaccacttaaattcatggacagagatcaatcttccctcttttgga |
105 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30671072 |
tgttggtcctaacctgaattaaaggtttaatggtgtcaaactcactactttgatctaccacttaaattcatggacagagatcaatcttccctcttttgga |
30670973 |
T |
 |
| Q |
106 |
caccattatttgcttcactttgttttcttctttgatccacacactgatgaaaaccctaataatatttgaatcacaagaaagnnnnnnntgatgcacttgt |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30670972 |
caccattatctgcttcactttgttttcttctttgatccacacactgatgaaaaccctaataatatttgaatcacaagaaagaaaaaaatgatgcacttgt |
30670873 |
T |
 |
| Q |
206 |
tattgcaatttttacaacaata |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30670872 |
tattgcaatttttacaacaata |
30670851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University