View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2342_low_14 (Length: 247)
Name: NF2342_low_14
Description: NF2342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2342_low_14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 30670242 - 30670489
Alignment:
| Q |
8 |
tgagaagaactaggtaaacaaatcatggtataatttttcctccacactctttatcttgttgtcttgctataattgtggttttgctttacacttagtttgc |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30670242 |
tgagatgaactaggtaaacaaatcatggtataatttttcctccactctctttatcttgttgtcttgctataattgtggttttgctttacacttggtttgc |
30670341 |
T |
|
| Q |
108 |
tagattagacctatatctgtttttgttgcgtgaggggggtttgattattggttgttattgatacttgttcc--------aagcttatttgtttgatttga |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30670342 |
tagattaaacctatatctgtttttgttgcttgaggtggttttgattattggttgttattgatacttgttccacacctgtaagcttatttgtttgatttga |
30670441 |
T |
|
| Q |
200 |
atccaaattcacaataaacacatataaacatgatcagaatgtctatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30670442 |
atccaaattcacaataaacacatataaacatgatcagaatgtctatat |
30670489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 134
Target Start/End: Original strand, 25652313 - 25652365
Alignment:
| Q |
81 |
tgtggttttgctttacacttagtttgctagattagacctatatctgtttttgtt |
134 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||| || |||| ||||| |
|
|
| T |
25652313 |
tgtggttttgctttacacttag-ttgctagattagatctaaatttgttgttgtt |
25652365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 81 - 136
Target Start/End: Original strand, 11660831 - 11660885
Alignment:
| Q |
81 |
tgtggttttgctttacacttagtttgctagattagacctatatctgtttttgttgc |
136 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||| ||||||| ||||||| |
|
|
| T |
11660831 |
tgtggttttgctttacacttggtt-gctagattagatctagatctgttgttgttgc |
11660885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University