View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2342_low_4 (Length: 369)
Name: NF2342_low_4
Description: NF2342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2342_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 69 - 360
Target Start/End: Complemental strand, 32061115 - 32060824
Alignment:
| Q |
69 |
tcggtctaataaaatttgatcttgctgttctcagtctaatgccactttacctgcttttgttctaaggtttcttggttttgttagaaagtcagtttcagct |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061115 |
tcggtctaataaaatttgatcttgctgttctcagtctaatgccactttacctgcttttgttctaaggtttcttggttttgttagaaagtcagtttcagct |
32061016 |
T |
 |
| Q |
169 |
ctttaaagtccatgttgcactttagagggtaaaaatatattttttgctaattcaaatcgaacatatgtttaggttttgctgttaagcagtctgactgtct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32061015 |
ctttaaagtccatgttgcactttagagggtaaaaatatattttttgctaattcaaatcgaacatatgtttaggttttgctgttaagcagtctgactgtct |
32060916 |
T |
 |
| Q |
269 |
agaattttttatcagtaaatgatttattcattgactatcccctgcttacggattcttaatttatcactcttgtgtgtttagacttgcctatg |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32060915 |
agaattttttatcagtaaatgatttattcattgactatcccctgcttacggattcttaatttatcactcttgtgtgtttaggcttgcctatg |
32060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University