View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2342_low_7 (Length: 342)
Name: NF2342_low_7
Description: NF2342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2342_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 19 - 331
Target Start/End: Original strand, 36676850 - 36677162
Alignment:
| Q |
19 |
ccatgtctttcactctatctctttcctcttcaggtaaacacataacaatcaatcaattttatttctatccttcgagggaaagtggaagatgatgatgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676850 |
ccatgtctttcactctatctctttcctcttcaggtaaacacataacaatcaatcaattttatttctatccttcgagggaaagtggaagatgatgatgaat |
36676949 |
T |
 |
| Q |
119 |
aaaatgttaagtatttttgggcttataaaggccttgttcaaggatacaacaatggacagtgatttttgcacgtgaaattccattaaatgtatatagatca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676950 |
aaaatgttaagtatttttgggcttataaaggccttgttcaaggatataacaatggacagtgatttttgcacgtgaaattccattaaatgtatatagatca |
36677049 |
T |
 |
| Q |
219 |
ttaactttacacggttaattgaatgatggttgttagataaaatcaaagcaattttagtcaatatcactctattattttattttagcatatgcggtccttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36677050 |
ttaactttacacggttaattgaatgatggttgttagataaaatcaaagcaattttagtcaatatcactctattattttattttagcatatgcggtccttt |
36677149 |
T |
 |
| Q |
319 |
gagtttgattcat |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36677150 |
aagtttgattcat |
36677162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University