View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2343_high_2 (Length: 340)
Name: NF2343_high_2
Description: NF2343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2343_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 14 - 328
Target Start/End: Original strand, 51582883 - 51583200
Alignment:
| Q |
14 |
ctttcattgatttccgtgatagcgcaactcactgtaaacttaggaaccgcaacagaa---gaagaagaattcgagaaacttcttttttgaaagtagagtc |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51582883 |
ctttcattgatttccgtgataccgcaactcactgtaaacttaggaaccgcaacagaagaagaagaagaattcgagaaacttcttttttgagagtagagtc |
51582982 |
T |
|
| Q |
111 |
tttgctgccggtgagagcgtggtaagggaagagatgaggatacggagattgaagcggtaattgtacgaaccggaagcgttgggagggttagagcgagtga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51582983 |
tttgctgccggtgagagcgtggtaagggaagagatgaggatacggagattgaagcggtaattgtacgaaccggaagcgttgggagggttagagtgagtga |
51583082 |
T |
|
| Q |
211 |
agctgaagtggaggtcacagtatccattggatttcaatgaagccaagccaatcgaagtaggaagtatagatagataacggaaagaataatattcactttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51583083 |
agctgaagtggaggtcacagtatccattggatttcaatgaagccaagccaatcgaagtaggaagtatagatagataacggaaagaataatattcactttc |
51583182 |
T |
|
| Q |
311 |
gaatatacgaggatgatg |
328 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51583183 |
gaatatacgaggatgatg |
51583200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University