View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2343_low_3 (Length: 287)
Name: NF2343_low_3
Description: NF2343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2343_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 2 - 272
Target Start/End: Original strand, 17327484 - 17327754
Alignment:
| Q |
2 |
gcagagacctctaaaacctttatgatacgcccataattatgattgtggaccgcaatttagaactaagtccctcgactcaagctttcttctccttaactgg |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327484 |
gcagagacctctaaaacttttatgatacgcccataattatgattgtggaccgcaatttagaacaaagtccctcgactcaagctttcttctccttaactgg |
17327583 |
T |
|
| Q |
102 |
tgacataaatagaaaccgataaaccatagcagcagaactagcaccaattaaaggacatatccaaaaaacataaaattgctcccaagtattgtgcttattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327584 |
tgacataaatagaaaccgataaaccatagcagcagaactagcaccaattaaaggacatatccaaaaaacataaaattgctcccaagtattgtgcttattg |
17327683 |
T |
|
| Q |
202 |
ttcatataagcccaaccaaatgcattagcagggttcatagaaggtccagtataaccagaaccaattataac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| || ||||| |
|
|
| T |
17327684 |
ttcatataagcccaaccaaatgcattagcagggttcatagaaggtccagtgtagccagaacctataataac |
17327754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University