View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2343_low_6 (Length: 250)
Name: NF2343_low_6
Description: NF2343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2343_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 3713985 - 3713759
Alignment:
| Q |
1 |
tcaaaatttagttctttactttgttttattgttttttgctgctatgttggaaagttgttgttgaacttgtatgaatgtgattgttttgttctataaaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713985 |
tcaaaatttagttctttactttgttatattgttttttgctgctttgttggaaagttattgttgaacttgtatgaatgtgattgttttgttctataaaaac |
3713886 |
T |
|
| Q |
101 |
tttgtttgatcctgtttgc---gttgttgtattggaaatttcctgacaaatattactttgttggctaatattacaatggtttttgttcactacttctata |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713885 |
tttgtttgatcctgtttgcattgttgttgtattggaaatttcctgacaaatattactttgttggctaatattacaatggtttttgttcactacttctata |
3713786 |
T |
|
| Q |
198 |
tattctaattgtttgttgaatctattt |
224 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
3713785 |
tattataattgtttgttgaatctattt |
3713759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University