View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2343_low_8 (Length: 237)
Name: NF2343_low_8
Description: NF2343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2343_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 10086445 - 10086665
Alignment:
| Q |
1 |
cgtatatatcgtgacttgcctttgattatatataccttatcaaataataaat-gttttgctttgtgaaaaaagaaattgagtatatatgggtgtaattcg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
10086445 |
cgtatatatcgtgacttgcctttgattatatataccttatcaa-taataaattgttttggtttgtgaaaaaagaaattgagtatatgtag-tgtaattcg |
10086542 |
T |
 |
| Q |
100 |
tattaaagttaattacgtatttgatttagtaaagactactttccaacacgcatgattctaactattgaaagagaatgaaagaatat-attttgaaaaagt |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10086543 |
tattaaagttaattacgtatatgatttagtaaagactactttccaacacgcatgattctaactattgaaagagaatgaaagaatatctttttgaaaaagt |
10086642 |
T |
 |
| Q |
199 |
tatataattacaatgtaaggttt |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10086643 |
tatataattacaatgtaaggttt |
10086665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University