View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2344_low_5 (Length: 225)

Name: NF2344_low_5
Description: NF2344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2344_low_5
NF2344_low_5
[»] chr4 (1 HSPs)
chr4 (18-212)||(837079-837272)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 837272 - 837079
Alignment:
18 taaactttgctaagaagttagcacaactattgcatacacaaagagtgtgaacaattgatatggtccgatcaaagttgagaagatcgttgatgtcttaaat 117  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
837272 taaactttgctaaga-gtcagcacaactattgcatacacaaagagtgtgaacaattgatatggtccgatcaaagttgagaagatcattgatgtcttaaat 837174  T
118 tagactaacatattcgtggcatcaagaaatttgccccttgagaatataaagtggaaagagttcaaatagcaaataacatcttgaagattcatctc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
837173 tagactaacatattcgtggcatcaagaaatttgccccttgagaatataaagtggagagagttcaaatagcaaataacatcttgaagattcatctc 837079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University