View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2345_high_7 (Length: 309)

Name: NF2345_high_7
Description: NF2345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2345_high_7
NF2345_high_7
[»] chr4 (1 HSPs)
chr4 (18-298)||(56492456-56492736)


Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 56492456 - 56492736
Alignment:
18 gtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagccacgaccatgctggaggtg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56492456 gtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagccacgaccatgctggaggtg 56492555  T
118 ctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttgctca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56492556 ctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttgctca 56492655  T
218 agttcttgatgctttgggagagtccgtcccctgcgctacttatgattcatggatggtccatgtacctgaagctgatttctt 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56492656 agttcttgatgctttgggagagtccgtcccctgcgctacttatgattcatggatggtccatgtacctgaagctgatttctt 56492736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University