View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2345_low_9 (Length: 298)
Name: NF2345_low_9
Description: NF2345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2345_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 218 - 288
Target Start/End: Original strand, 4800332 - 4800402
Alignment:
| Q |
218 |
aaacctacatcataagcttcagagattgtcttgaatttggcttcagcatctttcttgttattagggttctt |
288 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4800332 |
aaacatacatcataagcttcagagattgtcttgaatttggcttcagcatctttcttgttattagggttctt |
4800402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 218 - 288
Target Start/End: Complemental strand, 38859355 - 38859285
Alignment:
| Q |
218 |
aaacctacatcataagcttcagagattgtcttgaatttggcttcagcatctttcttgttattagggttctt |
288 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
38859355 |
aaacttacatcataagcttctgagatttgcttaaatttggcttcagcttcttttttgttattagggttctt |
38859285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University