View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_high_16 (Length: 280)
Name: NF2347_high_16
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 8 - 262
Target Start/End: Complemental strand, 43080068 - 43079814
Alignment:
| Q |
8 |
gaaaagaaaatcgagttcccaaggcagggcagaacattaattggatggttgcagacagtatctttgggggcaagcaaggtccaaatagcattaaatgacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43080068 |
gaaaagaaaatcgagttcccaaggcagggcagaacattaattggatggttgcagacagtatctttgggggcaagcaaggtccaaatagcattaaatgacc |
43079969 |
T |
 |
| Q |
108 |
cttgcttcattgaagtttcaaaatccctgccacttgccccaaatgaataatgaatccttcacattttaaaaatccaggatttaagggaccgatcttgcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43079968 |
cttgcttcattgaagtttcaaaatccctgccacttgccccaaatgaataatgaatccttcacattttaaaaatccaggatttaagggaccgatcttgcaa |
43079869 |
T |
 |
| Q |
208 |
aaaattcacaatttaaaagttaaagtatgtgacgataatttaaatagtgataaat |
262 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
43079868 |
aaaattcacaatttaaaagttaatgtatgtgacgataattaaaatagtgataaat |
43079814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University