View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_high_21 (Length: 249)
Name: NF2347_high_21
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 24997255 - 24997074
Alignment:
| Q |
1 |
ccttgttcatgttgtttgtttgccttttgttttctcatgaagatgtttttcagttaaaaaataacaattttgtcttatcattttgctaacctaaaattat |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24997255 |
ccttgctcatgttgtttgtttcccttttgttttctcatgaagatgtttttcagttaaaaaataataattttgtcttatcattttgctaacctaaaattat |
24997156 |
T |
|
| Q |
101 |
aaaatctaaaatatagtagctctcaacaattatacgcatcttgcatttttcgtcaagaaaatattagtgcataactgcatctaat |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24997155 |
aaaatctaaaata---tagctctcaacaattatacgcatcttgcatttttcgtcaagaaaatattagtgcataactgcatctaat |
24997074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 238
Target Start/End: Complemental strand, 24997075 - 24997037
Alignment:
| Q |
200 |
attatgagattagattgcactacacacttcaattatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24997075 |
attatgagattagattgcactacacacttcaattatatt |
24997037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University