View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2347_high_27 (Length: 238)

Name: NF2347_high_27
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2347_high_27
NF2347_high_27
[»] chr4 (2 HSPs)
chr4 (63-238)||(3445211-3445386)
chr4 (16-45)||(3445163-3445192)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 63 - 238
Target Start/End: Original strand, 3445211 - 3445386
Alignment:
Q  63 gtatgttagatgatgatataaaactatatgatagcgcttaatcgatgctatgatttatcgtttatgaacgttgataagatccttcgatctggcacagatc 162  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  3445211 gtatgttagatgatgatataaaactatatgatagcgcttaagcgatgctatgatttatcgtttatggacgttgataagatccttcgatctggcacagatc 3445310  T
Q  163 atcaattgggttggtttatgtcattttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaattt 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||    
T  3445311 atcaattgggttggtttatgtcattttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaattt 3445386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 45
Target Start/End: Original strand, 3445163 - 3445192
Alignment:
Q  16 caccattggcatcagttacttttcaggtaa 45  Q
    ||||||||||||||||||||||||||||||    
T  3445163 caccattggcatcagttacttttcaggtaa 3445192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University