View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_high_29 (Length: 230)
Name: NF2347_high_29
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 54195434 - 54195241
Alignment:
| Q |
19 |
atgttgaggctctggatttaatttctctctctctctcnnnnnnnnnnatagacacgggtggctttggtctcgtctcttgtcacatccttcgcattcacct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54195434 |
atgttgaggctctggatttaatttctctctctctct----tttttttatagacacgggtggctttggtctcgtctcttgtcacatccttcgcattcacct |
54195339 |
T |
 |
| Q |
119 |
gtaaaaggtttatatctttatggaggagtaggcactggcaaaactatgctgatggacttgttttatgatcaattgtgagtttgatgttaatttcttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54195338 |
gtaaaaggtttatatctttatggaggagtaggcactggcaaaactatgctgatggacttgttttatgatcaattgtgagtttgatgttaatttcttct |
54195241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University