View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_high_7 (Length: 415)
Name: NF2347_high_7
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 342
Target Start/End: Original strand, 25413091 - 25413414
Alignment:
| Q |
19 |
gttgataccaatggtgattcaattaggacagtactttcagatcaagaatatattgtgtttagctttagagaggatggatcatttgatgtagccacggaca |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25413091 |
gttgataacaatggtgattcaattaggacagtactttccgatcaagaatatattgtgtttagctttagagaggatggatcatttgatgtagacacggaca |
25413190 |
T |
|
| Q |
119 |
gtattgctgccaaatctgagtcttcaagtgtcgatggaaagcgtgaaaactcaaaggcagtgagtcgaaaggtacatattatacactcattgccattaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25413191 |
gtattgctgccaaatctgagtcttcaagtgttgatggaaagcgtgaaaactcaaaggcggtgagtcgaaaggtacatattacacactcattgccattaac |
25413290 |
T |
|
| Q |
219 |
aaaattctcaatttttcatataaattatacccctatgtcttggctagatatcatacatactatagatgtaatcatattatgtcataggtttttaatcgat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25413291 |
aaaattctcaatttttcatataaattatacccctatgacttggctagatatcatacatactatagatgtaatcatattatgtcataggtttttaatcgat |
25413390 |
T |
|
| Q |
319 |
tgcgagtatttatattgctgccaa |
342 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25413391 |
tgcgagtatttatattgctgccaa |
25413414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 389
Target Start/End: Original strand, 25413448 - 25413480
Alignment:
| Q |
357 |
tgcggttgttatgtcgttgtagataccttaaaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
25413448 |
tgcggttgttatgtcgttgtagatacattaaaa |
25413480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University