View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_low_28 (Length: 238)
Name: NF2347_low_28
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_low_28 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 63 - 238
Target Start/End: Original strand, 3445211 - 3445386
Alignment:
| Q |
63 |
gtatgttagatgatgatataaaactatatgatagcgcttaatcgatgctatgatttatcgtttatgaacgttgataagatccttcgatctggcacagatc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3445211 |
gtatgttagatgatgatataaaactatatgatagcgcttaagcgatgctatgatttatcgtttatggacgttgataagatccttcgatctggcacagatc |
3445310 |
T |
 |
| Q |
163 |
atcaattgggttggtttatgtcattttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaattt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3445311 |
atcaattgggttggtttatgtcattttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaattt |
3445386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 45
Target Start/End: Original strand, 3445163 - 3445192
Alignment:
| Q |
16 |
caccattggcatcagttacttttcaggtaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3445163 |
caccattggcatcagttacttttcaggtaa |
3445192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University