View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2347_low_30 (Length: 230)

Name: NF2347_low_30
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2347_low_30
NF2347_low_30
[»] chr4 (1 HSPs)
chr4 (19-216)||(54195241-54195434)


Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 54195434 - 54195241
Alignment:
19 atgttgaggctctggatttaatttctctctctctctcnnnnnnnnnnatagacacgggtggctttggtctcgtctcttgtcacatccttcgcattcacct 118  Q
    ||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||    
54195434 atgttgaggctctggatttaatttctctctctctct----tttttttatagacacgggtggctttggtctcgtctcttgtcacatccttcgcattcacct 54195339  T
119 gtaaaaggtttatatctttatggaggagtaggcactggcaaaactatgctgatggacttgttttatgatcaattgtgagtttgatgttaatttcttct 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54195338 gtaaaaggtttatatctttatggaggagtaggcactggcaaaactatgctgatggacttgttttatgatcaattgtgagtttgatgttaatttcttct 54195241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University