View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2347_low_31 (Length: 217)
Name: NF2347_low_31
Description: NF2347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2347_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 10838399 - 10838615
Alignment:
| Q |
1 |
tggagatgctcaaggcctgcttggtgaaaacggatatggtactcagagagcaaagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10838399 |
tggagatgctcaaggcctgcttggtgaaaacggatatggtactcagagagcaaagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattg |
10838498 |
T |
|
| Q |
101 |
gaaatgctgggagaagaacattcagccgcggttcttgtgaaaaggttggatttttggctttattatattgcatacttctgcggaggtacaattggtcttg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10838499 |
gaaatgctgggagaagagcattcagccgcggttcttgtgaaaaggttggatttttggctttattatattgcatacttctgcggaggtacaattggtcttg |
10838598 |
T |
|
| Q |
201 |
tttacagcaatattctt |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
10838599 |
tttacagcaataatctt |
10838615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University