View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2348_high_16 (Length: 255)
Name: NF2348_high_16
Description: NF2348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2348_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 35473131 - 35473243
Alignment:
| Q |
1 |
tctatttcatcttcccatatcttcaacttgcggattgtattccaaagctttggtttatcctccttctaataatttcatcttcaagctgggattaaaaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35473131 |
tctatttcatcttcccatatcttcaacttgcggattgtattccaaagctttggtttgtcctcgttctcataatttcatcttcaagctgggattaaaaagc |
35473230 |
T |
 |
| Q |
101 |
atatactctccgg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35473231 |
atatactctccgg |
35473243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 164 - 245
Target Start/End: Original strand, 35473244 - 35473325
Alignment:
| Q |
164 |
gacggattttagttatgttctaaccannnnnnnagtttgttagtcttatcctcttcccttcctagctgttccctttcctatg |
245 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473244 |
gacggattttagttatgttctaaccatttttttagtttgttagtctgatcctcttcccttcctagctgttccctttcctatg |
35473325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University