View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2348_high_22 (Length: 225)
Name: NF2348_high_22
Description: NF2348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2348_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 20 - 166
Target Start/End: Complemental strand, 38568037 - 38567891
Alignment:
| Q |
20 |
aacgtgaaatggaccgcacagcaaggaaagtagcacgacaaatttatgacccatatcagatagagaacacggacccgatgtacaaactcaaataaaactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38568037 |
aacgtgaaatggaccgcacagcaaggaaagtagcacgacaaatttatgacccatatcagatagagaacacggacccgatgtacaaactcaaacgaaactg |
38567938 |
T |
|
| Q |
120 |
attctttttcattttaagaagatacctaaagattttgtctcaaaacc |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38567937 |
attctttttcattttaagaagataccttaagattttgtctcaaaacc |
38567891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 207
Target Start/End: Complemental strand, 38567485 - 38567452
Alignment:
| Q |
174 |
gaaggaagacatcgattattagagaggtaaaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38567485 |
gaaggaagacatcgattattagagaggtaaaaat |
38567452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University