View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2348_low_26 (Length: 224)

Name: NF2348_low_26
Description: NF2348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2348_low_26
NF2348_low_26
[»] chr1 (1 HSPs)
chr1 (22-208)||(48635865-48636051)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 48636051 - 48635865
Alignment:
22 aagagaatttgggggatggggagtgtttggttgatgacaattgccatactcttatccttcggaatcatcgctcactctttcgacggcggcagcgcacccc 121  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48636051 aagagaacttgggggatggggagtgtttggttgatgacaattgccatactcttatccttcggaatcatcgctcactctttcgacggcggcagcgcacccc 48635952  T
122 ccaaacaacaaccaactctctgtgatgaactcattcttccagccggttacccttgctccgaatttgtggtatacatttactactttt 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48635951 ccaaacaacaaccaactctctgtgatgaactcattcttccagccggttacccttgctccgaatttgtggtatacatttactactttt 48635865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University