View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2349_high_5 (Length: 223)
Name: NF2349_high_5
Description: NF2349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2349_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 28 - 109
Target Start/End: Original strand, 47907295 - 47907376
Alignment:
| Q |
28 |
ggaagtgtttcggtgttttggagacaaggtttggataaggtcatattcaaaatgtattgtaaatagcattgtatttaaagtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907295 |
ggaagtgtttcggtgttttggagacaaggtttggataaggtcatattcaaaatgtattgtaaatagcattgtatttaaagtt |
47907376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University