View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2349_low_13 (Length: 251)
Name: NF2349_low_13
Description: NF2349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2349_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 24 - 215
Target Start/End: Complemental strand, 31823579 - 31823388
Alignment:
| Q |
24 |
cattcaacacaacaacaaacattgatgaggagaatgacgatttagacaacctatttgtgaaacctgacctgagttttgggagcttctctgcattgtttaa |
123 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31823579 |
cattcaacgcaacaacaaacattgatgaggagaatgacgatttagacaacctatttgtgaaacctgacctgagttttgggagcttctctgcattgtttaa |
31823480 |
T |
|
| Q |
124 |
tccaaacccgaatgatcttgattctagttcaatacttagggttaaaattggaggagctgtatcaaattcccctagtctttatctttatgcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31823479 |
tccaaacccgaatgatcttgattctagttcaatacttagggttaaaattggaggagctgtatcaaattcccctagtctttatctttatgcat |
31823388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 200 - 245
Target Start/End: Complemental strand, 34899946 - 34899901
Alignment:
| Q |
200 |
ctttatctttatgcatataaacacatctctctttagttcatctctc |
245 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34899946 |
ctttacctatatgcatataaacacatctctctttagttcttctctc |
34899901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University