View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2349_low_7 (Length: 317)

Name: NF2349_low_7
Description: NF2349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2349_low_7
NF2349_low_7
[»] chr2 (1 HSPs)
chr2 (78-196)||(44160324-44160453)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 78 - 196
Target Start/End: Complemental strand, 44160453 - 44160324
Alignment:
78 aataatatagccactgattgatttgaaagaactaaattagattacaaaatggtacaatat-----------tgtttgcatgatttttatgaaaatgatcg 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |           |||||||||||||||||||||||||||||    
44160453 aataatatagccactgattgatttgaaagaactaaattagattacaaaatggtacaatttctactccaatttgtttgcatgatttttatgaaaatgatcg 44160354  T
167 aatgttgaacctagtgaatgaaagataaaa 196  Q
    ||||||||||||||||||||||||||||||    
44160353 aatgttgaacctagtgaatgaaagataaaa 44160324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University