View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2350_low_4 (Length: 251)
Name: NF2350_low_4
Description: NF2350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2350_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 39078439 - 39078200
Alignment:
| Q |
16 |
atgtaataaaggtgtcactattccaaagtaattatttatttattttt-aaattcctttgcttc---cattgggccatctgaccagacccgattataattt |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39078439 |
atgtaataaaggtgtcattattccaaagtatttatttatttattttttaaattcctttgcttcttccattgggccatctgaccagacccgattataattt |
39078340 |
T |
 |
| Q |
112 |
caagcgccggatatatgattttaattagatagcggatcaattcaaattcaaataagataaaaaagtgtatagaaaatatatataatagaactggtcaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078339 |
caagcgccggatatatgattttaattagatagcggatcaattcaaattcaaataagataaaaaagtgtatagaaaatatatataatagaactggtcaatt |
39078240 |
T |
 |
| Q |
212 |
agccttgccaatcaagtctacattttctcattttggacaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078239 |
agccttgccaatcaagtctacattttctcattttggacaa |
39078200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University