View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_high_4 (Length: 353)
Name: NF2351_high_4
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 91 - 351
Target Start/End: Complemental strand, 56162199 - 56161927
Alignment:
| Q |
91 |
ataaattaagagactggactaacaaaatatgataacgaatctatggagatggttaaggtttcaaactccaatagaaatgaagagcttataacaaaaagtc |
190 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56162199 |
ataaattatgagactggactaacaaaatatgataatgaatctatagagatggttaagttttcaaactccaatagaaatgaagagcttataacaaaaagtc |
56162100 |
T |
 |
| Q |
191 |
caatat------------gtattttgtccagctaatgttttagaccaagattattgtcgatcttaaatgcaaaattgaaaatgtatttagtccaacctgg |
278 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56162099 |
caatataaatgtgaatatgtattttgtccagctaatgttttagaccaagattattgtcgatcttaaatgcaaaattgaaaatgtatttagtccaacctgg |
56162000 |
T |
 |
| Q |
279 |
aaatttaaaaatatctatgatttgtaagaaattacaggtgttgactgtgatggtcttttattctagactagac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56161999 |
aaatttaaaaatatctatgatttgtaagaaattacaggtgttgactgtgatggtcttttattctagactagac |
56161927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University