View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_high_7 (Length: 310)
Name: NF2351_high_7
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 28 - 189
Target Start/End: Original strand, 23964653 - 23964795
Alignment:
| Q |
28 |
caacttttgcacaaacctagtttatcgagacttccactcatatcaaaacccgaaaaatataacagccgcaaacccttactgcaaccaaccaccaatcggt |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23964653 |
caacttttgaacaaacctagtttatcgagacttccattcatatcaaaacccgaaaaatataacagccgcaaaccct-------------------tcggt |
23964733 |
T |
|
| Q |
128 |
aaccactggaagccagtcgtgaaccaactgggaggcataggaggtccgaccaaaaatcaact |
189 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23964734 |
aaccactggaagtcagttgtgaaccaacttggaggcataggaggtccgaccaaaaatcaact |
23964795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 236 - 305
Target Start/End: Original strand, 23964794 - 23964863
Alignment:
| Q |
236 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgctact |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23964794 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgttact |
23964863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University