View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_low_18 (Length: 313)
Name: NF2351_low_18
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 9780817 - 9781012
Alignment:
| Q |
1 |
ttcattgtaaaaaagatccagtaaaagttca---gctctcaacttcgactcagaatatagaatgcttttggattttgattgacttatatattttcagttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9780817 |
ttcattgtaaaaaagatccagtaaaagttcatcagctctcaacttcgactcagaatatagaatgcttttggatttggattgacttacatattttcagttt |
9780916 |
T |
|
| Q |
98 |
attttaacttaacgcttgatatgaatctcttgcaaaggttctctaaataaaaatgaatcacttgtaaaggtatatgggagaaagtatgcaagtaac |
193 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9780917 |
attataacttaacgcttgatatgaatcacttgcaaaggttctctaaataaaaatgaatcacttgtaaaggtatatgggagaaagtatgcaagtaac |
9781012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University