View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_low_23 (Length: 297)
Name: NF2351_low_23
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 58 - 246
Target Start/End: Complemental strand, 39139157 - 39138969
Alignment:
| Q |
58 |
gagcagagagcactatgaaaagagaacacaagtgtggctcgttgctcaacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139157 |
gagcagagagcactatgaaaagagaacacaagtgtggctcgttgctcaacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgta |
39139058 |
T |
|
| Q |
158 |
cactattacacacccagcttctttacttcacttcacatctgttttatcatcatcatcatcccctatgccgccactttttctgctgatca |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39139057 |
cactattacacacccagcttctttacttcacttcacatctgttttatcatcatcatcatcacctatgccgccactttttctgctgatca |
39138969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University