View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_low_24 (Length: 289)
Name: NF2351_low_24
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 50 - 242
Target Start/End: Complemental strand, 16486686 - 16486494
Alignment:
| Q |
50 |
cagagataaagacaaaactaggtttgttattaacaatgagatttttcagggccaatcttgaaggggcattggcaaatccccttatattccaatatagaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16486686 |
cagagataaagacaaaactaggtttgttattaacaatgagatttttcagggccaatcttgaaggggcattggcaaatccccttatattccaatatagaaa |
16486587 |
T |
|
| Q |
150 |
tttcatttggaaggtttatggttataaacctttgatctggttttgtagtttgatttagaggtgatggctttgttttgtgttttctttctgtgg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16486586 |
tttcatttggaaggtttatggttataaacctttgatctggttttgtagtttgatttagaggtgatggctttgttttgtgttttctttctgtgg |
16486494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 84 - 167
Target Start/End: Original strand, 24306697 - 24306780
Alignment:
| Q |
84 |
aatgagatttttcagggccaatcttgaaggggcattggcaaatccccttatattccaatatagaaatttcatttggaaggttta |
167 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||||||||| ||| |||||||||||| || | |||||||| |||||||| |
|
|
| T |
24306697 |
aatgaggtttttcaaggccaatcatgaaggggcattggcaaaaccctttatattccaatctatgaccttcatttgaaaggttta |
24306780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 145
Target Start/End: Complemental strand, 21004338 - 21004266
Alignment:
| Q |
73 |
ttgttattaacaatgagatttttcagggccaatcttgaaggggcattggcaaatccccttatattccaatata |
145 |
Q |
| |
|
|||||||| | ||| || ||||| || ||||||||||| ||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
21004338 |
ttgttatttagaattaggtttttgagtgccaatcttgatgggacattgacaaatccccttatattccagtata |
21004266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University