View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_low_26 (Length: 274)
Name: NF2351_low_26
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 1746996 - 1747141
Alignment:
| Q |
1 |
tacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcacattatataaaaatcttaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
1746996 |
tacaattcaagggaaagcaaagaaaaacaatgtaatttataactttgtataacacataactaattgcattatattgcaccttatataaaaatcttaccat |
1747095 |
T |
 |
| Q |
101 |
acaagattactaggaaattatggtgcatagagtaataatcaaatac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1747096 |
acaagattactaggaaattatggtgcatagagtaataatcaaatac |
1747141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University