View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2351_low_36 (Length: 223)
Name: NF2351_low_36
Description: NF2351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2351_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 113 - 199
Target Start/End: Original strand, 39793431 - 39793517
Alignment:
| Q |
113 |
ctctccctgcaacaggtttgtttctacttcccnnnnnnntgggactgagcacaacaaaagatcccatcatacgaagtggtaggttgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
39793431 |
ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgc |
39793517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University