View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2352_high_3 (Length: 353)
Name: NF2352_high_3
Description: NF2352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2352_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 17 - 336
Target Start/End: Original strand, 2260312 - 2260638
Alignment:
| Q |
17 |
agaacaaccgtgctgggtgggtgcctatactccctctttattcgtgctttctttattggtacgaattcgtgcaattttagtgtatgtttgatattaaggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2260312 |
agaacaaccgtgctgggtgggtgcctatactccctctttattcgtgcattctttattggtacgaattcatgcaattttagtgtatgtttgatattaaggt |
2260411 |
T |
 |
| Q |
117 |
ggatacgcaagaatcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgggt-------attttgacatatctatggtgatatc |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
2260412 |
ggatacgcaagaatcaccgtaattttgtagaaggtacaaattgtagtttctgaaaaatcacagtggatcgttgtaattttgacatatctatggtgatatc |
2260511 |
T |
 |
| Q |
210 |
aaacattatataatgtagcacaaaatactagggttttttaattaactaactgttacatttctgtgcctatccaaccaattgcagatgcttcagagcattg |
309 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2260512 |
aaacactatctaatgtagcacaaaatactaggtttttttaattaactaactgttacatttctgtgcctatccaaccaattgcagatgcttcagagcgttg |
2260611 |
T |
 |
| Q |
310 |
gaaatgctggaacatgaatattgctat |
336 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2260612 |
gaaatgctggaacatgaatattgctat |
2260638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 36322770 - 36322713
Alignment:
| Q |
127 |
gaatcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgggt |
184 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||||| |||| |||||| |
|
|
| T |
36322770 |
gaatcaccgtgattttgtagaagctacaaagtgtagtttttgaaaaatcacggtgggt |
36322713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University