View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2352_low_12 (Length: 214)
Name: NF2352_low_12
Description: NF2352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2352_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 1485125 - 1484941
Alignment:
| Q |
15 |
cataggaagtgctgaagaatcttcaattgaatttccaaatttaatttcaacccctctacttgatcatttcatttttgtatgttatattttgaagcaagac |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1485125 |
catagaaagtgctgaagaatcttcaattgcatttccaaatttaatttcaacctcactacttgatcatttcatttttgtatgttatattttgaagcaagac |
1485026 |
T |
 |
| Q |
115 |
gtggcttggcattgtaaccaagagaacgtgggaaaaaggaaatggataggatgcaaagttagtaatgtttcaaacataccaaagt |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1485025 |
gtggcttggcattgtaaccaacagaacgtgggaaaaaggaaatggataggatactaagttagtaatgtttcaaacataccaaagt |
1484941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University