View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2352_low_6 (Length: 249)
Name: NF2352_low_6
Description: NF2352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2352_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 49008153 - 49007918
Alignment:
| Q |
1 |
cacttggtgctggttttgtacctaaaacagttttattaaattgcatgcttgcttttggattagtattgcacttaatgaaatccttgataagttctccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49008153 |
cacttggtgctggttttgtacctaaaacagttttattaaattgcatgcttgcttttggattagtattgcacttaatgaaatccttgataagttctccatt |
49008054 |
T |
|
| Q |
101 |
aattggattcnnnnnnntagatggaaacttagtttgaatgtaatatgttatatcctcagaactatttgatatgaaaacacccgcaacaacttttattctg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49008053 |
aattggattcaaaaaaatagatggaaacttagtttgaatgtaatatgttatatcctcagaactatttgatatgaaaacacccgcaacaacttttattctg |
49007954 |
T |
|
| Q |
201 |
tccaagttatccacttgagtagcaagtgttcggttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49007953 |
tccaagttatccacttgagtagcaagtgttcggttc |
49007918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University