View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2352_low_9 (Length: 228)
Name: NF2352_low_9
Description: NF2352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2352_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 20 - 148
Target Start/End: Complemental strand, 19597091 - 19596963
Alignment:
| Q |
20 |
ccattacgaagagcatcacaatctaatgaacaacataatatgcagatcattgatccagttgaaatcttcatagcctttgccgcaacctcttgtgttttct |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19597091 |
ccattacgaagagcatcgcaatctaatgaacaagataatatgcagatcattgatccaattgaaatcttcatagtctttgccgcaacctcttgtgttttct |
19596992 |
T |
 |
| Q |
120 |
atctttcttacgtggtaagggagttcatg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19596991 |
atctttcttacgtggtaagggagttcatg |
19596963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University