View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2353_low_3 (Length: 240)
Name: NF2353_low_3
Description: NF2353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2353_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 41803653 - 41803432
Alignment:
| Q |
6 |
ttcccataaaatttactatctaaaatctttaagaagtgttttaagatattcattacaatttctcgtaatgatataacataagcggttaattgatgaaaat |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
41803653 |
ttcctataaaatttactatctaaaatctttaagaagtattttaagacattcattaacatttctcgtaaagatataacataagcggttaattgataaaaat |
41803554 |
T |
 |
| Q |
106 |
ttatgatgagactttcaagtcatcaattatgcatttgtcatcacttgtcatatgtgtcatacgaataaaggtttgcatgtcttcaagacaccacac---- |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41803553 |
ttatgatgagactttcaagtcatcaattatgcatttgtcatcacttgtcatatgtgtcatacgaataaaggtttgcatgtcttcaagacaccacaccaca |
41803454 |
T |
 |
| Q |
202 |
-cacatccacatggtttctttt |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41803453 |
ccacatccacatggtttctttt |
41803432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 3383326 - 3383284
Alignment:
| Q |
160 |
tgtcatacgaataaaggtttgcatgtcttcaagacaccacacc |
202 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3383326 |
tgtcatatgaataaatgtttgcatgtcttcaagacaccacacc |
3383284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University