View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2354_low_6 (Length: 307)
Name: NF2354_low_6
Description: NF2354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2354_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 24 - 302
Target Start/End: Complemental strand, 4369711 - 4369434
Alignment:
| Q |
24 |
acaagccacaacgtagggttacattacaagaagagagaggagccaccagagaacaaatgatggaaaagtgatttttctttgttacactagttttgtcttt |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
4369711 |
acaagccataacgtagggttacattacaagaagagagaggagccaccagagaacaaaagatggaaaagtgatttttctttgtttcactagtcttgtcttt |
4369612 |
T |
|
| Q |
124 |
gtccatgttctgaattcaacattggttagaaaaatataaggttcggaatttagattataaaccctacattttactctaatactttgctacgttaacctaa |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4369611 |
gtccatgttctga-ttcaacattggttagaaaaatataaggttcggaatttagattataaaccctacattttactctaatactttgctacgttaacctaa |
4369513 |
T |
|
| Q |
224 |
accctttgtctggttattttggtgttatatatctgcatttgtatgcattataggttctttttatttgcatgtgcctttg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4369512 |
accctttgtctggttattttggtgttatatatctgcatttgtacgcattataggttctttttatttgcatgtgtctttg |
4369434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University