View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_high_10 (Length: 371)
Name: NF2356_high_10
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 33421523 - 33421727
Alignment:
| Q |
1 |
accggggtccaacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421523 |
accggggtccaacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataag |
33421622 |
T |
|
| Q |
101 |
cctggtggtgaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaagttctgggaaggtataacattttcttactattcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421623 |
cctggtggtgaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaagttctgggaaggtataacattttcttactattcatat |
33421722 |
T |
|
| Q |
201 |
tcagg |
205 |
Q |
| |
|
||||| |
|
|
| T |
33421723 |
tcagg |
33421727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 266 - 331
Target Start/End: Original strand, 33421788 - 33421853
Alignment:
| Q |
266 |
ggtcttctgggttgtcataaaaataatttcttgcttgttgggtctccgcggttgtgataaaaatcc |
331 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33421788 |
ggtcttctgggttgtcataaaaatcattttttgcttgttgggtctccggggttgtgataaaaatcc |
33421853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 15695423 - 15695301
Alignment:
| Q |
19 |
cttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataagcctggtggtgaaggtgct |
118 |
Q |
| |
|
|||||| || ||||| ||| | || ||||||||||| || || || |||||||| | || ||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
15695423 |
cttcagcgagcgtccgcctacggatatggctccgctgtttccagggtgtgattatgaacattggcttattgttatggataaacctggtggtgaaggtgct |
15695324 |
T |
|
| Q |
119 |
accaaacagcagatgattgattg |
141 |
Q |
| |
|
| |||||||| ||||||||||| |
|
|
| T |
15695323 |
tcgaaacagcaaatgattgattg |
15695301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 100 - 177
Target Start/End: Complemental strand, 10508345 - 10508268
Alignment:
| Q |
100 |
gcctggtggtgaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaagttctgggaaggta |
177 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||| |||| || ||||||| ||| ||||||| |||||||| |
|
|
| T |
10508345 |
gcctggtggtgaaggtgcttctgagcagcagatgattgattattacatccaaaccctcgcaaaagttcttggaaggta |
10508268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University