View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_high_30 (Length: 234)
Name: NF2356_high_30
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 39078269 - 39078060
Alignment:
| Q |
1 |
ttacaacttgatagattgcttgaataggtgaatgagttgaataacacttcgtcgtcttagaggtggagtaattgcctccaaacacttcaaagctaaaatc |
100 |
Q |
| |
|
||||||||||| | |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078269 |
ttacaacttgaaaaattgcttgaataggtgaacgagttgaaaaacacttcgtcgtcttagaggtggagtaattgcctccaaacacttcaaagctaaaatc |
39078170 |
T |
 |
| Q |
101 |
aatatgagaatgcaatagaaattgtgtacctttcactgggactgtccttagtcattaggacgatctcgtgttggatcccccaccttctatcattgaaaca |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078169 |
aatatgagaatgcaataaaaattgtgtacctttcactgggactgtccttagttattaagacgatctcgtgttggatcccccaccttctatcattgaaaca |
39078070 |
T |
 |
| Q |
201 |
atctatctta |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
39078069 |
atctatctta |
39078060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University